A while back there was a discussion on this topic. Today's Washington post
reports on an article published in Science, I think, that collected genetic
samples from dog breeds and using genetic structures called microsatellites,
they were able to identify which breed the sample came from with a 99%
accuracy.

What's a microsatellite?

What's the difference between a genus like Phalaenposis whose members will
interbreed and a single species like Canis familiaris which is highly
polymorphic. How is it determined that Phals are not like dogs but really
separate species? I know, I know....just speculate and enlighten. I will
not get involved in this discussion should one develop. I plan to read
along if it takes off on it's own but just sigh if it dyes without comment.

Al
As I have sad many times recently: A homophone is a terrible thing to
waist.

The NY Times carried that story as well. I don't pretend to be a scientist,
but I did stay at a Holiday Inn.....

Diana

"Al" wrote in message
...
A while back there was a discussion on this topic. Today's Washington
post
reports on an article published in Science, I think, that collected
genetic
samples from dog breeds and using genetic structures called
microsatellites,
they were able to identify which breed the sample came from with a 99%
accuracy.

What's a microsatellite?

What's the difference between a genus like Phalaenposis whose members will
interbreed and a single species like Canis familiaris which is highly
polymorphic. How is it determined that Phals are not like dogs but really
separate species? I know, I know....just speculate and enlighten. I will
not get involved in this discussion should one develop. I plan to read
along if it takes off on it's own but just sigh if it dyes without
comment.

Al
As I have sad many times recently: A homophone is a terrible thing to
waist.

"Al" wrote in message ...
A while back there was a discussion on this topic. Today's Washington post
reports on an article published in Science, I think, that collected genetic
samples from dog breeds and using genetic structures called microsatellites,
they were able to identify which breed the sample came from with a 99%
accuracy.

What's a microsatellite?

A microsatellite is a short stretch of DNA (usually less than 1000
nucleotides) that consists of simple, repetitive sequence. For
example:

CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG etc

For reasons that are not entirely clear, the enzyme that replicates
DNA tends to "stutter" over these sequences and does not copy them
accurately. Thus, if you examine a particular microsatellite in
several members of the same species, you will often find different
lengths. The mutation rate is low enough that you can use
microsatellites to determine geneology. Related individuals are more
likely to have the same length. If you examine multiple different
microsatellites in the same individual, you will generate a genetic
fingerprint for that individual.

What's the difference between a genus like Phalaenposis whose members will
interbreed and a single species like Canis familiaris which is highly
polymorphic. How is it determined that Phals are not like dogs but really
separate species? I know, I know....just speculate and enlighten.

There are various definitions of a species, but one of the most
commonly used in Mayr's biological species concept: "... groups of
actually or potentially interbreeding natural populations which are
reproductively isolated from other such groups." Reproductive
isolation can be due to genetic factors so that no offspring are
produced even if mating occurs. Alternatively, reproductive isolation
can be due to anatomical or behavioral differences. For instance, in
orchids and other plants, reproductive isolation can be produced by
fragrance, flower shape, or flowering time even though there is no
genetic barrier. This is what allows human with toothpicks to produce
fertile hybrids between unambiguously different species. The natural
populations of Phalaenopsis consist of different species, despite what
happens in our greenhouses.

As with everything else in biology, there are exceptions to the rule,
because evolution is an ongoing process: Natural hybrids and hybrid
swarms do occur in some orchids (e.g. Cattleya guatemalensis). Ring
species in seagulls are the classic textbook examples of incomplete
reproductive isolation. In some mice, a cross between male of strain
A and female of strain B is fertile, but a cross between male B and
female A is sterile. So, are A and B different species?

Nick

"Al" wrote in message
...
A while back there was a discussion on this topic. Today's Washington
post
reports on an article published in Science, I think, that collected
genetic
samples from dog breeds and using genetic structures called
microsatellites,
they were able to identify which breed the sample came from with a 99%
accuracy.

What's a microsatellite?

What's the difference between a genus like Phalaenposis whose members will
interbreed and a single species like Canis familiaris which is highly
polymorphic. How is it determined that Phals are not like dogs but really
separate species? I know, I know....just speculate and enlighten. I will
not get involved in this discussion should one develop. I plan to read
along if it takes off on it's own but just sigh if it dyes without
comment.
"Diana Kulaga" wrote in message thlink.net...
The NY Times carried that story as well. I don't pretend to be a scientist,
but I did stay at a Holiday Inn.....

Microsatellites are simple repeated sequences in DNA such as
AGAGAGAGAGA. In general they have no particular function, but
because the replication machinery has problems with them,
accidents occur fairly frequently, so they vary in length between
individuals. This polymorphism is useful for gene mapping and
dog classifying operations.

It would be interesting to do a similar exercise in orchids,
but I suspect there's not much genome sequence data available.
I've just looked and there are over 300 sequence entries from
Phalaenopsis in GenBank, but they are largely ribosomal and
chloroplast sequences done by Tsai,C.C. and Chou,C.H. for a
taxonomic study which would be really interesting but as far
as I can see it's unpublished.

A species is one of those things that's obvious until you try
to define it in detail, and opinions do vary, and it is more
of a construct than a solid biological reality. The usual
species concept is that of a population which interbreeds in
nature (ie freakish crosses in captivity and reproductive barriers
caused by artificial selection don't count), but individual cases
are often unclear and subject to debate.

My feeling as a geneticist is that it doesn't take much to
cause hybrid sterility, possibly one incompatible gene in otherwise
closely related strains, or perhaps a chromosomal rearrangement.
This means the inability to interbreed is possibly not the most
useful criterion.

Leo

Ah! Now I get it! I thought you were trying to ID by their jeans! (Mine
are always naked...) Silly me, with all of this talk about homophones. ;-#
--
Reka

This is LIFE! It's not a rehearsal. Don't miss it!
http://www.rolbox.it/hukari/index.html

"Myrmecodia" schrieb im Newsbeitrag
om...
"Al" wrote in message
...

What's a microsatellite?

A microsatellite is a short stretch of DNA (usually less than 1000
nucleotides) that consists of simple, repetitive sequence. For
example:

CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG etc




---
Outgoing mail is certified Virus Free.
Checked by AVG anti-virus system (http://www.grisoft.com).
Version: 6.0.690 / Virus Database: 451 - Release Date: 22.05.04

Reka wrote:

Ah! Now I get it! I thought you were trying to ID by their jeans! (Mine
are always naked...) Silly me, with all of this talk about homophones. ;-


Our class motto (biochem) was "You can change your pants, but we
can change your genes".


Rob

--
Rob's Rules: http://www.msu.edu/~halgren
1) There is always room for one more orchid
2) There is always room for two more orchids
2a. See rule 1
3) When one has insufficient credit to purchase
more orchids, obtain more credit
LittlefrogFarm is open for business - e-mail me for a list of
minicatts and oncidiums )