Home |
Search |
Today's Posts |
#1
|
|||
|
|||
Identifying species by their genes.
A while back there was a discussion on this topic. Today's Washington post
reports on an article published in Science, I think, that collected genetic samples from dog breeds and using genetic structures called microsatellites, they were able to identify which breed the sample came from with a 99% accuracy. What's a microsatellite? What's the difference between a genus like Phalaenposis whose members will interbreed and a single species like Canis familiaris which is highly polymorphic. How is it determined that Phals are not like dogs but really separate species? I know, I know....just speculate and enlighten. I will not get involved in this discussion should one develop. I plan to read along if it takes off on it's own but just sigh if it dyes without comment. Al As I have sad many times recently: A homophone is a terrible thing to waist. |
#2
|
|||
|
|||
Identifying species by their genes.
The NY Times carried that story as well. I don't pretend to be a scientist,
but I did stay at a Holiday Inn..... Diana "Al" wrote in message ... A while back there was a discussion on this topic. Today's Washington post reports on an article published in Science, I think, that collected genetic samples from dog breeds and using genetic structures called microsatellites, they were able to identify which breed the sample came from with a 99% accuracy. What's a microsatellite? What's the difference between a genus like Phalaenposis whose members will interbreed and a single species like Canis familiaris which is highly polymorphic. How is it determined that Phals are not like dogs but really separate species? I know, I know....just speculate and enlighten. I will not get involved in this discussion should one develop. I plan to read along if it takes off on it's own but just sigh if it dyes without comment. Al As I have sad many times recently: A homophone is a terrible thing to waist. |
#3
|
|||
|
|||
Identifying species by their genes.
"Al" wrote in message ...
A while back there was a discussion on this topic. Today's Washington post reports on an article published in Science, I think, that collected genetic samples from dog breeds and using genetic structures called microsatellites, they were able to identify which breed the sample came from with a 99% accuracy. What's a microsatellite? A microsatellite is a short stretch of DNA (usually less than 1000 nucleotides) that consists of simple, repetitive sequence. For example: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG etc For reasons that are not entirely clear, the enzyme that replicates DNA tends to "stutter" over these sequences and does not copy them accurately. Thus, if you examine a particular microsatellite in several members of the same species, you will often find different lengths. The mutation rate is low enough that you can use microsatellites to determine geneology. Related individuals are more likely to have the same length. If you examine multiple different microsatellites in the same individual, you will generate a genetic fingerprint for that individual. What's the difference between a genus like Phalaenposis whose members will interbreed and a single species like Canis familiaris which is highly polymorphic. How is it determined that Phals are not like dogs but really separate species? I know, I know....just speculate and enlighten. There are various definitions of a species, but one of the most commonly used in Mayr's biological species concept: "... groups of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups." Reproductive isolation can be due to genetic factors so that no offspring are produced even if mating occurs. Alternatively, reproductive isolation can be due to anatomical or behavioral differences. For instance, in orchids and other plants, reproductive isolation can be produced by fragrance, flower shape, or flowering time even though there is no genetic barrier. This is what allows human with toothpicks to produce fertile hybrids between unambiguously different species. The natural populations of Phalaenopsis consist of different species, despite what happens in our greenhouses. As with everything else in biology, there are exceptions to the rule, because evolution is an ongoing process: Natural hybrids and hybrid swarms do occur in some orchids (e.g. Cattleya guatemalensis). Ring species in seagulls are the classic textbook examples of incomplete reproductive isolation. In some mice, a cross between male of strain A and female of strain B is fertile, but a cross between male B and female A is sterile. So, are A and B different species? Nick |
#4
|
|||
|
|||
Identifying species by their genes.
"Al" wrote in message
... A while back there was a discussion on this topic. Today's Washington post reports on an article published in Science, I think, that collected genetic samples from dog breeds and using genetic structures called microsatellites, they were able to identify which breed the sample came from with a 99% accuracy. What's a microsatellite? What's the difference between a genus like Phalaenposis whose members will interbreed and a single species like Canis familiaris which is highly polymorphic. How is it determined that Phals are not like dogs but really separate species? I know, I know....just speculate and enlighten. I will not get involved in this discussion should one develop. I plan to read along if it takes off on it's own but just sigh if it dyes without comment. "Diana Kulaga" wrote in message thlink.net... The NY Times carried that story as well. I don't pretend to be a scientist, but I did stay at a Holiday Inn..... Microsatellites are simple repeated sequences in DNA such as AGAGAGAGAGA. In general they have no particular function, but because the replication machinery has problems with them, accidents occur fairly frequently, so they vary in length between individuals. This polymorphism is useful for gene mapping and dog classifying operations. It would be interesting to do a similar exercise in orchids, but I suspect there's not much genome sequence data available. I've just looked and there are over 300 sequence entries from Phalaenopsis in GenBank, but they are largely ribosomal and chloroplast sequences done by Tsai,C.C. and Chou,C.H. for a taxonomic study which would be really interesting but as far as I can see it's unpublished. A species is one of those things that's obvious until you try to define it in detail, and opinions do vary, and it is more of a construct than a solid biological reality. The usual species concept is that of a population which interbreeds in nature (ie freakish crosses in captivity and reproductive barriers caused by artificial selection don't count), but individual cases are often unclear and subject to debate. My feeling as a geneticist is that it doesn't take much to cause hybrid sterility, possibly one incompatible gene in otherwise closely related strains, or perhaps a chromosomal rearrangement. This means the inability to interbreed is possibly not the most useful criterion. Leo |
#5
|
|||
|
|||
Identifying species by their genes.
Ah! Now I get it! I thought you were trying to ID by their jeans! (Mine
are always naked...) Silly me, with all of this talk about homophones. ;-# -- Reka This is LIFE! It's not a rehearsal. Don't miss it! http://www.rolbox.it/hukari/index.html "Myrmecodia" schrieb im Newsbeitrag om... "Al" wrote in message ... What's a microsatellite? A microsatellite is a short stretch of DNA (usually less than 1000 nucleotides) that consists of simple, repetitive sequence. For example: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG etc --- Outgoing mail is certified Virus Free. Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.690 / Virus Database: 451 - Release Date: 22.05.04 |
#6
|
|||
|
|||
Identifying species by their genes.
Reka wrote:
Ah! Now I get it! I thought you were trying to ID by their jeans! (Mine are always naked...) Silly me, with all of this talk about homophones. ;- Our class motto (biochem) was "You can change your pants, but we can change your genes". Rob -- Rob's Rules: http://www.msu.edu/~halgren 1) There is always room for one more orchid 2) There is always room for two more orchids 2a. See rule 1 3) When one has insufficient credit to purchase more orchids, obtain more credit LittlefrogFarm is open for business - e-mail me for a list of minicatts and oncidiums ) |
Reply |
Thread Tools | Search this Thread |
Display Modes | |
|
|
Similar Threads | ||||
Thread | Forum | |||
Questions about alleles and genes | Plant Science | |||
Expression of SOD and some stress related genes | Plant Biology | |||
purple Norway Maples; recessive genes or mutation? | Plant Science | |||
QPCR control genes | Plant Biology | |||
Genes can explain convergent evolution? | Plant Science |