"Al" wrote in message ...
A while back there was a discussion on this topic. Today's Washington post
reports on an article published in Science, I think, that collected genetic
samples from dog breeds and using genetic structures called microsatellites,
they were able to identify which breed the sample came from with a 99%
accuracy.

What's a microsatellite?

A microsatellite is a short stretch of DNA (usually less than 1000
nucleotides) that consists of simple, repetitive sequence. For
example:

CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG etc

For reasons that are not entirely clear, the enzyme that replicates
DNA tends to "stutter" over these sequences and does not copy them
accurately. Thus, if you examine a particular microsatellite in
several members of the same species, you will often find different
lengths. The mutation rate is low enough that you can use
microsatellites to determine geneology. Related individuals are more
likely to have the same length. If you examine multiple different
microsatellites in the same individual, you will generate a genetic
fingerprint for that individual.

What's the difference between a genus like Phalaenposis whose members will
interbreed and a single species like Canis familiaris which is highly
polymorphic. How is it determined that Phals are not like dogs but really
separate species? I know, I know....just speculate and enlighten.

There are various definitions of a species, but one of the most
commonly used in Mayr's biological species concept: "... groups of
actually or potentially interbreeding natural populations which are
reproductively isolated from other such groups." Reproductive
isolation can be due to genetic factors so that no offspring are
produced even if mating occurs. Alternatively, reproductive isolation
can be due to anatomical or behavioral differences. For instance, in
orchids and other plants, reproductive isolation can be produced by
fragrance, flower shape, or flowering time even though there is no
genetic barrier. This is what allows human with toothpicks to produce
fertile hybrids between unambiguously different species. The natural
populations of Phalaenopsis consist of different species, despite what
happens in our greenhouses.

As with everything else in biology, there are exceptions to the rule,
because evolution is an ongoing process: Natural hybrids and hybrid
swarms do occur in some orchids (e.g. Cattleya guatemalensis). Ring
species in seagulls are the classic textbook examples of incomplete
reproductive isolation. In some mice, a cross between male of strain
A and female of strain B is fertile, but a cross between male B and
female A is sterile. So, are A and B different species?

Nick